Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14375H10
Clone ID IST14375H10
Vector VICTR74
Project tigm

Sequence tag IST14375H10HMF1
Sequence
AACACCCCCCTCCAAAAAGACAAAGAAATGAAGGCCCATCCCAGAAACAGGTTGAGTCAAAGCTTTTCATGATTTAAGTC
CAGATATTACATGTCTCCGTCTATCCCCAAGTAGTGAGTGGCAGGTTTATCATCTTCACAGCCATTTATCCCACAGAATC
TTACCTTTTCTCAGATTAAGAACCAAGAAACATTTTTCCTCCAGTCTTTAATTACAAATGAATGGACCCAGCCTCAGTGG
CTTCTATCACTCAAAGGAATCCACATGTATCTCCACATTAATAGAAATCTTTATAAAAGCTGAGCTTAGTGGCTTGGGCT
TCAGTGGATGACCCAGGTTTCAGGCNAGCTTGGGATACATCTTAAGGCCCTGCCCCCTAAAACAAAACCCTGGGCATCCT
AGTTTACTTATTTTATTCCAGCACNANNANGCAAANNTANGTGGATCTCTGAAAGANGTNAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98627989..98628452 444
 
EST/CDNA Est Name
  CR518955.1


Sequence tag IST14375H10BBF1
Sequence
AACACCCCCCTCCAAAAAGACAAAGAAATGAAGGCCCATCCCAGAAACAGGTTGAGTCAAAGCTTTTCATGATTTAAGTC
CAGATATTACATGTCTCCGTCTATCCCCAAGTAGTGAGTGGCAGGTTTATCATCTTCACAGCCATTTATCCCACAGAATC
TTACCTTTTCTCAGATTAAGAACCAAGAAACATTTTTCCTCCAGTCTTTAATTACAAATGAATGGACCCAGCCTCAGTGG
CTTCTATCACTCAAAGGAATCCACATGTATCTCCACATTAATAGAAATCTTTATAAAAGCTGAGCTTAGTGGCTTGGGCT
TCAGTGGATGACCCAGGTTTCAGGCCAGCTTGGGATACATCTTAAGGCCCTGCCCCCTAAAACAAAACCCTGGGCATCCT
ANTTTACTTATTTNATTCCAGCACANNGANGCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98628020..98628452 423
 
EST/CDNA Est Name
  CR518955.1


Sequence tag IST14375H10HMR1
Sequence
GTGTTGAGTCTTGCTACNTAGCCNAGGCATTTCTGAAACTGTCTTATCTCAGCCTCTACAGCTCGGAAAGTGCAGGTGTA
TGCCATCACATCTTGCTTGTATATCTTCCCACCTCCGGACAGGTTAATGCTGTAGCCCGTGCTGACTTCAAATGGCAAAG
GCTACTTANAATTACAGGAATAACCCGCCTTACTCNNTTTCCTGGAGCCATGTGTGGTGGTACACTCACCTAGCACACAA
GAGGCANAGGCCAGCCTGGTCTAGAATTCCAGGATAGCGAGGGCTACACANANAATCCCTGTCTCAAAAAATTGTTTTGA
AAATGCTTTGTCATTAAATCACTTCCACCCGTTGAAAACATTTAAAAATATGGTTGTCCNGAAAAACTATGCTGTCNANA
GTTACN
Sequence Type genomic DNA
Unitrap ID UNI6843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 98628448..98628852 383
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031311 (Nono) NM_023144 non-POU-domain-containing, octamer binding protein Gene [Source:MGI (curated);Acc:Nono-001]

 
Come back to gene ENSMUSG00000031311


For any suggestions or comments, please send an email to unitrap@crg.es