Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10469E2
Clone ID IST10469E2
Vector VICTR76
Project tigm

Sequence tag IST10469E2HMR1
Sequence
CAAGAATTAACAGTTAAAAGTCNGGTTTCAAACCCCGGGGTAGCTAGGAACCTANAGAGAACCTGCCGCCTTCCAACTGT
TCACCCCGTGGGAACCCAGGATGTCCAGTGGTTGANGAGAGGTTCAAAAACAAAAACCCAGCTTTCCTTTTGTCCGACTT
GGGGGTTTCTGCCGTGTGGTTTCCTACTTTGGAGATTTCAAATTTGACATAGGTCTGGATCCTGCTAATCACAGATCCCA
CAACATCCGCTGAAGCTAAAGAGGAGAANATCCAGTAACCTTGATTTGGGCTCTTGACACTANCTTGCTTTGGCCCAAAA
TACTTTTGGAGTGGTGGACAGCTGCNNANNTCNGGTGGTANATGTCNTN
Sequence Type genomic DNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122609126..122609491 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]

 
Come back to gene ENSMUSG00000004455


For any suggestions or comments, please send an email to unitrap@crg.es