Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14286A7
Clone ID IST14286A7
Vector VICTR74
Project tigm

Sequence tag IST14286A7HMR1
Sequence
NNCTACACGTGAACAGTGGTCCTTCCNGGAATGTGTGCGGGCGCCCCCCCCTCCCCCCACAGAGTTTCTCTGTATCCCTG
GCTGTCCTGGAACTCACTCTGTAAACCAGGCTGGCCTCAAACTCANAAATCCACCTGCCTCTGCCTCCCAAGTGCTGGAA
TTAAAGGTGTGCACCACCACTGCCCGGGTAATGTATGTTTTGTANCCTCTTAAAATAGGAGTCTAGAGTGGGGCATAGTG
TCATAGGCTGGTATCTAGGGTCTANAGTGAAATGAANCCACTGTANTTGTTAAGGAATAATACTTTTGATTGATTGATGG
TGGCACTGTTTANGCTCTTCTTTTCTTTCACAANTAAACACAGTANCCNACTTGGTCANANGGCCNCTNGN
Sequence Type genomic DNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109874004..109874389 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es