Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10310E8
Clone ID IST10310E8
Vector VICTR76
Project tigm

Sequence tag IST10310E8BBF1
Sequence
CTAATCCTACTTAAAGCCTGGGATTGCAGGTATGGACCCCCACATCTGTTTTATGCAGTACTGAGAATCACATCAGGGCC
TAGTACATCCCAGACAAGACTCTACTGACTAAGCTACATCTCCATACCTTACCATTCTTCTTCTTCTTGTTCTTCTTCTT
CTTGATGTTCTTCTTGTTCTCCTTCTCCTTGCTTCTGTCTCTTACAGTCTAAGATTATTATTTAAAAAATAAGTTCTAAA
ATGTCACAGTTTCAGCATTAAACATANTAAGTCATANATTGAACCAATGAAAAGAANGTTCTTTGAGCCTGGTAATGGTG
GTGCACACCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCANATTTCTGAGTTCAAGGCCNNCCTGGTGTACAGAGTG
AGTTCCAGGACAGCCNGGGCTATACAGAGAAACCCTGTTTCAAAAAACCNAAACAAAAACCNAAACNAAAAAACCNCAAA
ACAAAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12593775..12594261 465
NO GENE  


Sequence tag IST10310E8HMF2
Sequence
GGATAATAGTTTTGTTTCTGTGTTACACATATTTTGTGTCTTTAATCTTTTTGTTTGTTTGTTTGGTTTTGGTTTTTTTT
CAAGACAGGGTTTCTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTCTGTAAACCAGGCTGGCCTCNAACTCANAAATCC
ACCTGCCTCTGTCTCCCAAGTGCTGGGATTAAAGGCGTGCGCCACCACTGCCCANNTGTGTCTTTAATCTTGTATGTGCA
TTTATACAGAGCTGTATCAGGTATACCCACTGTTGTATATATATCCATATACATATTAAAATCTAGAGTGTGCATATACG
TAAATATGAAAGCTTTCACACATATGTGTTGCATGTATAATGTATGCTTTCCTATATGCAACATATACAAATAGGGGCTG
AATGTGGCACAGTGGTNANAGCACTGGCTGCTCTTACAGANGACCAGGGTTCAATTCCCTAAAACCACATTGTGGCTGAC
AACCNTCTGTAATGAGANTCGATGCCCTCTTCCGGTGTGTTTGAANACNGCTACNGTGTACTCNTATNCATAAAATGAAT
AANTNANTN
Sequence Type genomic DNA
Unitrap ID UNI17425

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57017274..57017835 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es