Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568D7
Clone ID IST14568D7
Vector VICTR74
Project tigm

Sequence tag IST14568D7HMF2
Sequence
GTTAAGCTCACCGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAAGCACATAGTGGCTCACAACCATCTGTAAT
GGGGTCTGATGCCTTCTTCTTGTGTGTCTGAAGACAGCAATGGTGTACTCATATACATAAAATAAATATTAAAAAATACT
C
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88832159..88832318 156
NO GENE  


Sequence tag IST14568D7BBF1
Sequence
GCCTTTAATCCCAGCACTTGGGAGGTAGAGGCAGGCA
Sequence Type genomic DNA
Unitrap ID UNI16285 UNI36277 UNI36278 UNI36279

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 91725373..91725409 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 17815294..17815330 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019854 (Reps1) NM_009048 RalBP1 associated Eps domain containing protein Gene [Source:MGI Symbol;Acc:MGI:1196373]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 56780312..56780348 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32749351..32749387 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 25850331..25850367 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 22399193..22399229 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 51827877..51827913 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16819038..16819074 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6461173..6461209 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079733 (AC183095.3-201)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 28992468..28992504 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 31424577..31424613 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052920 (Prkg1) NM_011160 protein kinase, cGMP-dependent, type I Gene [Source:MGI Symbol;Acc:MGI:108174]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 12399094..12399130 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 14054649..14054685 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039717 (Ralyl) NP_848746 RALY RNA binding protein-like Gene [Source:MGI Symbol;Acc:MGI:1924147]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 27920207..27920243 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 50529621..50529657 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19897809..19897845 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11084686..11084722 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 23956314..23956350 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59376655..59376691 37
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12844527..12844563 37
NO GENE  

 
Come back to gene ENSMUSG00000039717


For any suggestions or comments, please send an email to unitrap@crg.es