Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15000B5
Clone ID IST15000B5
Vector VICTR78
Project tigm

Sequence tag IST15000B5BBF1
Sequence
CAATCAGATATACATTAGATTGGTCACTGAAGGTGCTAGGTGGTGCTTTTCTGCTTGCTTTTGAAACTTCTCATTAGTGA
GGCCAAGGACCAAAGAAGAAAAACTTCCAGGAGGGCAGAGCATGTCCACTGACTCAATGCAGAGTTCAGGGCTTAGCAAA
GGACTTGGCATGAAACAGGTAGCCAGATATCTTGTCTCAGTTAATCCCTGCATGTAAGAACCACGGTACTGAACTCCCTT
TGAACATCTTGGCCTATCCTAAGCAATTTTGGAAGACACAAGATGAGGACATTTCCTTAGTCACATCTGCTTACAACATG
TACTGNAAACACCTCCAGCANANANCANCNNGTCATCTCACCNNANATTTCTAGAANCNNACCACCNNGCNNNANGAANA
ANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15000B5HMR1
Sequence
GCTTAAAAATATTACAGGCTAACAANATGGCTCANCTGGCAAAGATGTCTGCTGCTGGCTTCACANGGTNAAAAGGAGAG
AACAGACTCCTGAAAATTGTCTTCTGACCTCCATGTGTATAGCATAAACAACCTCCCCGGGGAGTGGGGGTGGGGAGGCC
N
Sequence Type genomic DNA
Unitrap ID UNI20161

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 150731060..150731219 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059119 (Nap1l4) NM_008672 nucleosome assembly protein 1-like 4 Gene [Source:MGI Symbol;Acc:MGI:1316687]

 
Come back to gene ENSMUSG00000059119


For any suggestions or comments, please send an email to unitrap@crg.es