Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0450
Clone ID AG0450
Vector pGT0lxr
Project sanger

Sequence tag AG0450
Sequence
ACACAGCTTCCCGATGGCCCGAGCCAAAACCACCATGAAGAAAGCCTATTACTTGGCCTGTGGATTTTGTCGATGTACAT
CGAGAGGGGGGGGCATGTTCAGACAAATGGGTTGTTAGTTTTTTTTAGCATGTTGGTGGGAACTTTTTCAAAAGGGTTTT
TTTTTTTGTTGATTGAGTATTACCAGCAGCTTGCTCAGAAGGAAAAGGTCGAACGAGATCGCAAGAAGCTGGCACGGCGA
AGAAATTACATGCCTTTGGCTTTTTCG
Sequence Type mRNA
Unitrap ID UNI3281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 60697985..60703800 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024603 (Dctn4) NM_026302 dynactin 4 Gene [Source:MGI Symbol;Acc:MGI:1914915]

 
Come back to gene ENSMUSG00000024603


For any suggestions or comments, please send an email to unitrap@crg.es