Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13848F10
Clone ID IST13848F10
Vector VICTR74
Project tigm

Sequence tag IST13848F10BBF1
Sequence
CTGATTGAACTACTTGAGGGCTCCTTTGTCTTCTTGAGACAGGGTCTTAAGTGGGCAGCTCCAGTTGGCTTGATATATAT
AGGATATCCCCAGCTGAGGCTACCTACTTTTATTTTTTTCANAGCTGAGGACCAATCCCAGGGCCTTGCACTTGCTAGGC
AAGCACTCTACCACTGAGCTANATCCCAATTGACTTTTGTTTGTTTGCATAGTGTATATATTANGCCTGGCTTGCTACCA
TAGGTTNATAATCTGANCTACTTGAGAGGCTAAGGCAGGATCATAAGTTGGTCAGTCNACTGGAGTCTGTTTTACAAACA
AAGTCACAACTTTTTGTTTAACATTCTATCTGTTTTCTGTAACAAATAATTAAGACTGTCTTGTTAATCATTCTCTCCAT
GCTANGCANGCACTTTGTCNCTGGGCACCTTATATTCCCAGTTCATGANNNANTTTTGTTGTTATTGNTGTTTANAGTGN
Sequence Type genomic DNA
Unitrap ID UNI1536

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108174555..108175033 449
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es