Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14091D5
Clone ID IST14091D5
Vector VICTR74
Project tigm

Sequence tag IST14091D5BBF1
Sequence
CCCCTTCCTAGTTGACCCCACTCCCAGCCCCGGTGCTGTTTTGCTGGGGGCAGGGTGGGCGGGCAGACACGACTTGTGAG
ACGGTAATGGGAGTGCTAGACTCGCCCTGGGAAGTTTATAGAAGAGGTTTCCAGCAGCCTAAAGGGGAGAAAGGTAAAGT
TTCAGGAATGAGAGAGTGAATGGGGTTCGGTGCGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI20638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35187520..35187718 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007041 (Clic1) NM_033444 chloride intracellular channel 1 Gene [Source:MGI Symbol;Acc:MGI:2148924]

 
Come back to gene ENSMUSG00000007041


For any suggestions or comments, please send an email to unitrap@crg.es