Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14283F6
Clone ID IST14283F6
Vector VICTR74
Project tigm

Sequence tag IST14283F6HMR1
Sequence
GTTGCTGGAATTTGAACTCCAGACCTTTGGAAGAGCAGTCAGTGCTCTCAACTGCTGANCCATCTCATCANCCCCCTCAT
TTATTTTTCTAAACAGGGGCTCTCTCTGTACCTGAAATGCACTGGCTAGATTGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44402514..44402647 130
NO GENE  


Sequence tag IST14283F6BBF1
Sequence
CAACCNCATGGTGGCTCACAACCATTCATAACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI36283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42543300..42543339 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019802 (Sec63) NM_153055 SEC63-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Sec63-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79959982..79960021 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 121897945..121897984 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 21698143..21698182 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123124274..123124313 38
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 44402644..44402683 38
NO GENE  

 
Come back to gene ENSMUSG00000019802


For any suggestions or comments, please send an email to unitrap@crg.es