Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14617C5
Clone ID IST14617C5
Vector VICTR74
Project tigm

Sequence tag IST14617C5HMF1
Sequence
CCTTCCCGATGCTGTGACTCTTTCACTCACTTCCTCCATGCTGTGGTGATCCCATGCATAAAATTATTTTTATTTCTATT
GCATAACTGTNNNNNTGTTACTGTTATGAATCATAATGTAAATATCTGTGTTTTCCAATGGTCTCAGGCAACCCCTGTGA
AAAGGCCATTTGACTCAAAGGAATCTTTTTTTTTTTTTTTTTTTTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4608019..4608228 196
NO GENE  


Sequence tag IST14617C5HMR1
Sequence
AAGGTAGAGAACCNCTGACTAGGGTCACTACCTAGCCTGGCTGACCTGGAACTTGCTCTGTAGACCAGGCTGGCCTCAGC
TCACTGAGATCCAACCTGCCTCTGCCTCCCCAGTGCTAGGATTAAAGGCGTGCACCATTGTGCCCAGCTTTCATTTTTCC
CTTTTTTTTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4608225..4608406 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]


Sequence tag IST14617C5BBF1
Sequence
CCTTCCCGATGCTGTGACTCTTTCACTCACTTCCTCCATGCTGTGGTGATCCCATGCATAAAATTATTTTTATTTCTATT
GCATAACTGTAATTTTGTTACTGTTATGAATCATAATGTAAATATCTGTGTTTTCCAATGGTCTCAGGCAACCCCTGTGA
AAAGGCCATTTGACTCAAAGGAATCTTTTTTTTTTTTTTTTTTTTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4608019..4608228 206
NO GENE  

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es