Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10438B6
Clone ID IST10438B6
Vector VICTR76
Project tigm

Sequence tag IST10438B6HMF1
Sequence
TTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTTGAACA
Sequence Type genomic DNA
Unitrap ID UNI31996 UNI31997

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 19041804..19041848 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 114517056..114517100 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 103532024..103532068 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033004 (Mycbp2) NP_997098 MYC binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2179432]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6148224..6148268 45
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 48388271..48388315 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063434 (Sorcs3) NM_025696 sortilin-related VPS10 domain containing receptor 3 Gene [Source:MGI Symbol;Acc:MGI:1913923]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140501484..140501528 45
NO GENE  

 
Come back to gene ENSMUSG00000063434


For any suggestions or comments, please send an email to unitrap@crg.es