Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056C8
Clone ID IST15056C8
Vector VICTR80
Project tigm

Sequence tag IST15056C8BBF1
Sequence
CTCTTTGGCACCTGATTCCCAACGTCGGAATAGGAGTTGCCACACATCCACAGAAGTAAAAATCACAAACTACACACTCA
AACTGCAAATTCAAACAACCATAAATGGTAAACTCATTTAAATTATGAAGAAGCAAGCCATTGATCAAATTCCCAAGCCA
GATGTCTCCGAAAAGTCATTAAAACTGTAGATACAAATTCCAGGGGAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53983274..53983490 217
NO GENE  


Sequence tag IST15056C8HMR1
Sequence
TACTNNTTTGAGGATCTTTGTGGGATACATTAATTACGGGCAGTCTAAAGACTGGTAGCTTTCAGTTTGGTTATCTTAAA
AGGTACTTCCTTATGTTACTTGAGCATTAAGTTGTTTTCAGCTCTTATTGTTATGGTAATGTTAAAAGCTTGGGTGAAGT
CTGGGGGTGTGGTGTAGGATATTGTATACTAATGGCCTGAATTACTGCATCAGGGTTGAAATAATTTAGGGTTGTAAATA
CTGAATGTATTGTTCAGAAATATTCTTCCACTAGTTGATCACTACTTTTAGAAGATACATTACCCTTAAAGTCATATGCA
GCTTCTTCTCTATATAAAGTTGTACACAAAGAGTTGTTGAGGACATAGAAGANGAGGTCTAAGGAATGTTGGCACTTTGG
AAAGCTTTTTAAAAACGTGGTTATTAGAATTTATAGGCGGAANACTTGCAGTATAAGGCACACTTTATGAACATACATNN
AATTGTGAGAATTTGCATTTGTTTCATACTNNNTGCNNAACN
Sequence Type genomic DNA
Unitrap ID UNI15611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 53983516..53984036 499
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039191 (Rbpj) NM_009035 recombination signal binding protein for immunoglobulin kappa J region Gene [Source:MGI Symbol;Acc:MGI:96522]

 
Come back to gene ENSMUSG00000039191


For any suggestions or comments, please send an email to unitrap@crg.es