Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11849G1
Clone ID IST11849G1
Vector VICTR76
Project tigm

Sequence tag IST11849G1HMF1
Sequence
GTTCAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGTTACACAGAGAAACCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 156801592..156801654 63
NO GENE  


Sequence tag IST11849G1BBF1
Sequence
GTTNAAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGTTACACAGANAAACCN
Sequence Type genomic DNA
Unitrap ID UNI30772 UNI30774

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 107359946..107360007 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 78172181..78172242 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 25106714..25106775 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4774266..4774327 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 48534224..48534285 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 81217117..81217178 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21221918..21221979 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4797679..4797740 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54495945..54496006 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 86581473..86581534 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 111055893..111055954 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19978144..19978205 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030400 (Ercc2) NM_007949 excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene [Source:MGI (curated);Acc:Ercc2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 41376439..41376500 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64227224..64227285 58
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 117842230..117842291 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034755 (Pcdh11x) NP_001074854 protocadherin 11 X-linked Gene [Source:MGI (curated);Acc:Pcdh11x-001]

 
Come back to gene ENSMUSG00000034755


For any suggestions or comments, please send an email to unitrap@crg.es