Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11618C6
Clone ID IST11618C6
Vector VICTR76
Project tigm

Sequence tag IST11618C6HMR1
Sequence
CTGCACAGTAAAGAACCNAAAGTTCAGATTCAAGACACGTTGAAGTATAAAAAACTGCCTGTTCTGAAGCATAACATTTA
GAATTTGGTTGTTGCTGGGGAAATTGCCTGTTAGTGGTGCAAGGCAGGGCTCTTTGGTTGTG
Sequence Type genomic DNA
Unitrap ID UNI36284

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82820205..82820346 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035476 (Map3k7ip3) NM_025729 mitogen-activated protein kinase kinase kinase 7 interacting protein 3 Gene [Source:MGI (curated);Acc:Map3k7ip3-001]

 
Come back to gene ENSMUSG00000035476


For any suggestions or comments, please send an email to unitrap@crg.es