Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10030C1
Clone ID IST10030C1
Vector VICTR75
Project tigm

Sequence tag IST10030C1HMR1
Sequence
ACCNNGNTACNNACTCTCTGTAAGGTGGGCGGGTCTAATGCATCCTCCCAAAAGGTGTTTGTGGGGGGTTTTGTTTGTTT
GTTTGTTTGTTTGTTTGTTTGAGACAGAGCCTCAAGAAGCTCAGATTTGACCTCAAAACCATGCATTGATGCCCTTGTAT
TTCAGTCTTCCTTGCCTGTACCTCCTGAGAGCTGAGATGATCAGCATCCGCTGTTTATATGGTGCTGGGACCACACCAAG
GGCTTCNGTGTATGGTANACAGGTGTTCTTCTGATTCACTCCATTCCTANCCCCANAAAGATACTATTTTTTTCNAGACA
GGGTTTCTCTGTGTNNCCCTGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGCCTTGAACTCANNAATCCGCCTGCCT
CTGCCTCCTGAGTGCTN
Sequence Type genomic DNA
Unitrap ID UNI13456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22117776..22118191 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es