Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10187F4
Clone ID IST10187F4
Vector VICTR76
Project tigm

Sequence tag IST10187F4BBF1
Sequence
CCTCTTAGTTGACTTAGTTGTCTGGTGGGTCTGCTAGCTTTGTTTCAAGACCTGCCAGCCAGTGACAGCCTGTGATTGTC
AACACCTTTGGAGATGACCATGAATACTAAAGCAGATGCCCTGAGGTGTCTAGATGCAAATGGAACCATCATTCAGGGCA
TAGGATTTGTAACAGAGCCTCANAGAACCATCTAATTTGTATAANAGAAAGCTGCTTTAACATCTAATGATTGGNCANAG
GCTGTGTTTAATCATTTTCTCTTGCTTTAAAGATGGGAATTTGGGGGAGGGGGTCACTGATGCAATGAGTAAACTATCTT
CCATTCATTAAAGAAGCAATGTTGTGGTTTACAGATGGCCTGACTGTANCTATCATCTATGAAAACCGTTCCTGCATCCG
ACANNNGGGAAGGGAGAGAAAAAGGGCAGTGAGGGAGAGGAAGAGTTTTCTCCGCCAGAACCAAATTCCATGANATTATT
TCTTTGTTTCAAATCCTTTGCATTTCCTTANCTGN
Sequence Type genomic DNA
Unitrap ID UNI9019

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114313332..114313845 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031954 (Cfdp1) NM_011801 craniofacial development protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344403]

 
Come back to gene ENSMUSG00000031954


For any suggestions or comments, please send an email to unitrap@crg.es