Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12824G10
Clone ID IST12824G10
Vector VICTR76
Project tigm

Sequence tag IST12824G10BBF1
Sequence
CAAAAAACAAACTTTATTCCCCAAGTTGTTTTTGGTCTTGGTCTTCATCAGAGCAACAGTAACACTAAGGCACTGTGTAC
AGAANATGTCCCTACCTCTCTGATCTCACAAAATACTCTTGGTANAATGGGTTTTGTTGTTATTTGTTTGTTTTTTGTTT
TGTTTTGTTTTTCCCANACCAGCTTCTACCTCCTGAGTGCTGGGATTAAAGGCGTGCCCTGCCNCTACCTANATCTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 107005651..107005887 227
NO GENE  


Sequence tag IST12824G10HMR1
Sequence
CCATAGATGGGAACTGTGAGTCATTGAGAAGTTCTAGTTGTGTGTTCAGACATCTTTTGGAGTCAGAAGAGCATTGAGTT
GGTAGTTCCATGGGACCTGCTGAAGTGATCCCAGGAGAGGCCTTGGAACCCAAATTGAGGCAGGCAAGGGATAACAAGGA
NAAATCAAGTGGCNNGTGTCCTAACACCCATTTTTCCCTCTAACCTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI29231

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106578140..106578350 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040813 (Tex264) NP_035703 testis expressed gene 264 Gene [Source:MGI Symbol;Acc:MGI:1096570]

 
Come back to gene ENSMUSG00000040813


For any suggestions or comments, please send an email to unitrap@crg.es