Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14734B11
Clone ID IST14734B11
Vector VICTR76
Project tigm

Sequence tag IST14734B11HMF2
Sequence
CTCATTATGTAGTGCAGGTTGCTCTTGAGTTCAAGATCTTCAAGTCTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54722414..54722463 50
NO GENE  


Sequence tag IST14734B11BBF1
Sequence
NGANCNNNGNANGGNGGGCNNGNTNANCNNCNNAAACNNNNGNNGTCNNTGGNANTNNNNNNNNGCNNCNNTTTNNNCTC
CCAGGGTTACTCTGAGGTCCGCCTATGTTGCGGATCAGAGCTCTGAATTCTCAGCCTGCCTTAATTTGCTGTGGGACTGT
CCAGGATTCCAGGGACTCACGGATCT
Sequence Type genomic DNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940518..25940625 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es