Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14959H11
Clone ID IST14959H11
Vector VICTR76
Project tigm

Sequence tag IST14959H11HMF1
Sequence
GGATCACACAGCTATATTTAGTTTATACCTAATATGGATGAAGTCCTGACCGAAGCCATTTCCTCTCTCCACAAAAAGAA
ACTTCCTTGCTTTTCTTCTATCAACAATGCAAAGGGTGGGCTCCTCTGAAGGGGGAGTTTTAAAAAAGTAAAGAAAGGAA
AGAGAGAAGGCTGGAAAAAAACATTGACAAATTAGGATGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134810889..134811087 199
 
EST/CDNA Est Name
  BB845290.1 - BY317047.1


Sequence tag IST14959H11BBF1
Sequence
NGANNANGGNANANNNGGNNNNNNNNNNNNNNNNNNNNANNTNNTNNNNNANTCCATTTTATNTCTCCNCANAAAGAAAC
TTCCTTGCTTTTCTTCTATCAACAATGCAAAGGGTGGGCTCCTCTGAAGGGGGAGTTTTAAAAAAGTAAANAAAGGAAAG
AGAGAAGGCTGGAAAAAAACATTGACNANTTANGATGTGGCTTATTAAAAACTCTGCCCNCTTTNNNNTTGCTAAACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14959H11HMR1
Sequence
ATCCAGGGCTGAAGTCNCACTTACACAGCTTCCTAAGCAGGGCTAATGAGATCNNCCAGTACTTTTCAGTCTCCCTCCTC
CCTGGCTTCTTGGTTCACTGGAAAGGCTACTCCGTTGATTAGCCCTGTGGTCTGTGTATACCTCTGCCCCTTAAAATATA
TCAGAACGTTTACAGGGACTCTTAAAGTAAACTTTAAAAAAACAAGTGAAACATTTTGACTTTGTCATTGTGTCACTACA
CCTCCTTCAANCTGGCTTTGTAAGTTTTAAGCCTTTGTCACAGGCATCTTGACTCTGGGCTGGACTCTTGTGAGCGGCAT
GCTCTATGATCCCANTGTGGCNNAGTGGCAATAAGATTTGATCTGATTGGCTGCCTATANANGANGCAGANGAATANGAA
NATGGGANAANCCTCCTGTTTTGGCN
Sequence Type genomic DNA
Unitrap ID UNI7776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134810468..134810892 395
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037242 (Clic4) NM_013885 chloride intracellular channel 4 (mitochondrial) Gene [Source:MGI (curated);Acc:Clic4-001]

 
Come back to gene ENSMUSG00000037242


For any suggestions or comments, please send an email to unitrap@crg.es