Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST443080
Clone ID OST443080
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST443080
Sequence
GACTGAGAGGACATTTGGATCTCCGGTTCAGTTTTAGAATGGCATCCGTCTCAGCTTTGACAGAGGAACTGGAATCCGTA
GCCAGTGAGCTTCATGCCATTGACATCCAGATTCAGGAACTCACAGAGAGGCGGCAAGAGCTCCTTCAGAGAAAGTCAGT
CCTGACAGGGAAAATCAAACAGTACTTGGAGGACTCTTCGGCTGAGGCGAGCAGCGACTTGGACACATCACCAGCTGCTT
GGAATAAAGAAGATTTTCCATGGTTCGGAGAGGTAAAAGATGTGCTGCAAAATGTTTTTAAACTGCAAAAATTCAGAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI17432

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 142325416..142333095 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030243 (Recql) NM_023042 RecQ protein-like Gene [Source:MGI Symbol;Acc:MGI:103021]

 
Come back to gene ENSMUSG00000030243


For any suggestions or comments, please send an email to unitrap@crg.es