Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11467A8
Clone ID IST11467A8
Vector VICTR76
Project tigm

Sequence tag IST11467A8BBF1
Sequence
TGNNTCTTTGTTTANTTTTTTTTCCTGATCTGTCCNTTGNTGANANTGANGTGTTGAANTCTCCCACTATTATTGGGTGA
GGTACAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11467A8HMR1
Sequence
TGGGAACTGGGAAGCTNATGTGGATCTCTGTAAGAGCAGCAAGTGCCCGTGGCTGCTGGACCGTTGTCCAGCCTCATACT
CCATATTTAAGGGCTTCTGTCCCCTGAGCCTCTCGTGAACTTTTTCCCCACTTTGTAGATTCGGTCATATTTCTTGTCAA
AACAAGAGTGGAACTTGACCCCAAGTCTTTTTCTAAGCACATTCTTTATTCCATGCTGTTACTAGTATACACAGCTCCTG
GGCCTCCTAAGTGCTGGGATTACAGGCATGTGCCACGAAGCCTGACTCGTTCCTGAGATCATGGAACCGCCACATCTCTG
CAGTGGCTCCCCTCAGAGTTTCATTGGCCTCACCAGACTTATGTCACAGACTCACTTCTTCTGTGTGTGTGTGGTTTTTT
TCTCCCCTGCANACATGCGTCGGGATGTCCAGGAAATTTTTCGCATGACCCCCCATGANAAGCAGGTCATGATGTTCAGT
GCTACCTTGANCAAAGAGATCCGCCCAGTCTGCCGCAAGTTCATGCNAGANGTAAATACCCTTCTACCTTCTCTCCCTCC
ACTCCCCGCCCNCTGCCTTCTCCCCCTCNTCGCCCTNTTCCTCCANANTCCCTNGTCNTTNNAGCNNCANNANNNGNNCC
Sequence Type genomic DNA
Unitrap ID UNI5528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35385484..35386108 595
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019432 (Bat1a) NM_019693 HLA-B-associated transcript 1A Gene [Source:MGI Symbol;Acc:MGI:99240]

 
Come back to gene ENSMUSG00000019432


For any suggestions or comments, please send an email to unitrap@crg.es