Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13674B4
Clone ID IST13674B4
Vector VICTR74
Project tigm

Sequence tag IST13674B4BBF1
Sequence
CTTTCTTTCTTTCTCTCTCTCTTTCTCTCTTTCTA
Sequence Type genomic DNA
Unitrap ID UNI25567 UNI36288 UNI36289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 20326490..20326523 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 32258808..32258841 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040711 (Sh3pxd2b) NM_177364 SH3 and PX domains 2B Gene [Source:MGI (curated);Acc:Sh3pxd2b-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88391986..88392019 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034145 (Tmem63c) NM_172583 transmembrane protein 63c Gene [Source:MGI Symbol;Acc:MGI:2444386]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 86587904..86587937 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 85643469..85643502 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84029587..84029620 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 84226940..84226973 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 27235033..27235066 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 105879874..105879907 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 147329681..147329714 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 143626786..143626819 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 82587519..82587552 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 72416821..72416854 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110723333..110723366 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032493 (1700036D21Rik) NM_148940 RIKEN cDNA 1700036D21 gene Gene [Source:MGI Symbol;Acc:MGI:1920586]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 54423936..54423969 34
NO GENE  

 
Come back to gene ENSMUSG00000032493


For any suggestions or comments, please send an email to unitrap@crg.es