Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12039A1
Clone ID IST12039A1
Vector VICTR76
Project tigm

Sequence tag IST12039A1HMF1
Sequence
CTTCCTACCTTCCTTTCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTTTCTTTCT
Sequence Type genomic DNA
Unitrap ID UNI12861 UNI36290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 133439704..133439769 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 117169376..117169441 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 63725873..63725938 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6005081..6005146 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 43118297..43118362 64
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 129280964..129281029 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030868 (Dctn5) NM_021608 dynactin 5 Gene [Source:MGI (curated);Acc:Dctn5-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 76047215..76047280 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059383 (Gfral) NM_205844 GDNF family receptor alpha like Gene [Source:MGI Symbol;Acc:MGI:3607786]

 
Come back to gene ENSMUSG00000059383


For any suggestions or comments, please send an email to unitrap@crg.es