Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13922B4
Clone ID IST13922B4
Vector VICTR74
Project tigm

Sequence tag IST13922B4BBF1
Sequence
AAGGCCAGCCTGGTCTGCAAAGTGAGTTCCAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTTGAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI31659 UNI31660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 110092182..110092253 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044749 (Abca6) NM_147218 ATP-binding cassette, sub-family A (ABC1), member 6 Gene [Source:MGI (curated);Acc:Abca6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22952229..22952300 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 71100292..71100363 70
NO GENE  

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es