Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14785B4
Clone ID IST14785B4
Vector VICTR76
Project tigm

Sequence tag IST14785B4HMR1
Sequence
GTGCTCTTCACTGACGGGCTACCCATGGCTTCCTCAGCCTGCTTTAAACAACAGATTCATTGATTGTTTTAGCGCTTCAC
TACAGAATTATCTCCACTTAGTTCTTTGCTCCCAGGGACAATGATGAGAAAATACTGCCGGAAACATCTCCATTAAGTAT
TACCCTTATGTTTTTCTCTGCGCCNTCGTTAGCCAAGTTTTTTTTTTTTTTAAAN
Sequence Type genomic DNA
Unitrap ID UNI15400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76348201..76348411 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048490 (Nrip1) NM_173440 nuclear receptor interacting protein 1 Gene [Source:MGI (curated);Acc:Nrip1-001]


Sequence tag IST14785B4BBF1
Sequence
GCACTCCGCCATGGCCTCTGGGTCANCGCCTGCTCCTAGGTTACTGCCCTGTTTGAGCTCCTGTCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76348408..76348474 65
NO GENE  


Sequence tag IST14785B4HMF2
Sequence
GCACTCCGCCATGGCCTCTGGGTCAGCGCCTGCTCCTAGGTTACTGCCCTGTTTGAGCTCCTGTCTCGATGACGTGGAAG
TTAGCCAAATAATCCCTTTCCCCTCCAAGTTGCTTTGGTCATTGTGTTTGGTCAAAACAATACTAACCCTAGCTATGACA
AGACTAGTCACAATTGTTGCCAGTAGTGCTAAGTCGAAGCCCGATTCATTTAACTGTAAAATAGACAGTAACCAAGTGGA
AGGCACAAGGCTCAGTAAAGTTGGGTAACTTGTAGCTAAGTGGTGCTGGGATTGGCATGTGAACCAGTTTGGCTTTGTAA
TGCAAGTCACAGACACCACAAACACGCCCTCCATATTATCACACCAAAACTGCCTGGGTNAGCAGANTCCCTGAGACATT
CACCAGANACTGACAGTCTATTCAGAAACCAGGCATTTGGTGCCTACAGCTGTGCTACAGACACAAACAGACAGATATTC
NAGTCCTTTATGANCCANNNAGACACCATGAATAANAAAACATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76348408..76348931 506
 
EST/CDNA Est Name
  CD351690.1 - CO430206.1 - BY752316.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1 - BB638015.1 - BB617901.1 - AA600404.1 - AI647209

 
Come back to gene CD351690.1 - CO430206.1 - BY752316.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1 - BB638015.1 - BB617901.1 - AA600404.1 - AI647209


For any suggestions or comments, please send an email to unitrap@crg.es