Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13339A10
Clone ID IST13339A10
Vector VICTR74
Project tigm

Sequence tag IST13339A10BBF1
Sequence
TTTGGACCTCCTCCTGGCCNAANAAAAANGCCCNAAACAGGACCTTTCTNANACNCTGTGTTGCTTTGGCANTTCCCNNG
TGGTACNNACTCTCNCCTAANCNNACTAAATTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13339A10HMF1
Sequence
TGGACATCTTATGAATTGAGAATTTATTGATATCTAAATCTGACTTATTAATTACAAGCTTCTACAGTTTTGATTTTACC
AGGTTCCTGGGATTTTGGACTGCTGACCACAGGGGGCANATGCTGGGAATGTGAGCAGAGTCATCAGCAGCAGAACCACA
GCTGATTGGTCATAAGCTGCTGCATGGGGCAGCTGTGGAGGCAGCAGGGGTTGCCGGGGCAGAGAATANCTGGAAATANC
AGGAGATGTTGCTGCTTTTTTAATATTTCCCGCAACACATATGAACTTGTTGCANAAAAGAAAACATGGTCACCTCTAAT
CCAGGTAACAACAATGGAGCTCATTTTGGGTAAATACTTACCAGGGTTGAATTTTTTANCNNAAAATATCTAANTTAATA
TATCANGATGTCTTGGGGAGGGTTCTGGGNAGTGAGTGTGTCNNATCTCACTTANANANTCNTNNTNNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 10472437..10472897 429
 
EST/CDNA Est Name
  BB249866.1 - CF897047.1 - CF171504.1 - CK623342.1 - CF747198.1 - CF896204.1 - CF747251.1 - CN711250.1 - BF134050.1 - CB840892.1 - BF140699.1 - BG804798.1 - DT931431.1 - CB273819.1 - BB855211.1 - CD552746.1 - CA530087.1 - CF182597.1 - AA671882.1 - CN674153


Sequence tag IST13339A10HMR1
Sequence
CAAATACAAGATATCTGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGAGCACTGAAACTCAGAGGAG
AGAATCTGTCTCCCAGGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACAATCTCTAAACAGAGTCC
Sequence Type genomic DNA
Unitrap ID UNI14866 UNI31252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 4551219..4551368 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 9747319..9747468 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8050139..8050288 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 7809459..7809608 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3110285..3110434 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3288450..3288599 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079407 (AC186757.2) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q9D9B9]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 3871295..3871444 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3385289..3385438 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17692356..17692505 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3031849..3031998 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9829060..9829209 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6761843..6761992 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7083476..7083625 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8119256..8119405 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 4601832..4601981 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 4232671..4232820 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5812568..5812717 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 6638349..6638498 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4183150..4183299 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 48187..48336 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166309: 114658..114807 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 134097..134246 150
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 10102549..10102698 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058254 (Tspan7) NM_019634 tetraspanin 7 Gene [Source:MGI (curated);Acc:Tspan7-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2531082..2531231 150
NO GENE  

 
Come back to gene ENSMUSG00000058254


For any suggestions or comments, please send an email to unitrap@crg.es