Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14162E8
Clone ID IST14162E8
Vector VICTR74
Project tigm

Sequence tag IST14162E8HMR1
Sequence
CATGTATGTGAGTTCCTGTGTGTGGAGGCCAGAGGTCC
Sequence Type genomic DNA
Unitrap ID UNI16274

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338549..24338585 37
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036473 (Tbc1d24) NM_173186 TBC1 domain family, member 24 Gene [Source:MGI Symbol;Acc:MGI:2443456]


Sequence tag IST14162E8HMF1
Sequence
CATGTATATACATACACAGGTCCCAGGGGAAAACACAAACATTTATAGCTCAGCTCACAGGCTCCAAGAAGCCCAAAGAC
CTGGGATTAACTGAGATGCTAGGACAGTGTCCTTTGTGTGCTGTGCTGGGAGCAAGGCTGGAANAGCCCAGGAANAAAGA
AGGTCCTAGGGTGGGAGTATGTCCCATAACCCACTCCTTCTAAAGGTCCACAAGCTTCCAAGGCAGGTGTGCTGGAAAGG
GCCCTGCTGANAAAGANGGTCANAAACTAGCACAAAGGANCAAAGTGACTCAAGATGAGGCTGGTANATTGAAGGGAAGG
GCANCCTTTGGTGAGACCCANACAGTGAGTGACACTTANAACAGCAAACCAGTTTTTATTCNTAATANACTCACCTATCA
GTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24338582..24338984 379
 
EST/CDNA Est Name
  BB652809.1 - BB659310.1 - CJ120077.1 - CJ111145.1 - CJ124986.1 - CN698874.1 - CJ108320.1 - CJ113294.1 - CJ127605.1 - CJ113360.1 - CJ113218.1 - CJ105130.1 - CJ123875.1 - CJ105182.1 - CJ114407.1 - CJ106071.1 - CJ113547.1 - CJ110624.1 - CJ115897.1 - CJ105173

 
Come back to gene BB652809.1 - BB659310.1 - CJ120077.1 - CJ111145.1 - CJ124986.1 - CN698874.1 - CJ108320.1 - CJ113294.1 - CJ127605.1 - CJ113360.1 - CJ113218.1 - CJ105130.1 - CJ123875.1 - CJ105182.1 - CJ114407.1 - CJ106071.1 - CJ113547.1 - CJ110624.1 - CJ115897.1 - CJ105173


For any suggestions or comments, please send an email to unitrap@crg.es