Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12243B5
Clone ID IST12243B5
Vector VICTR76
Project tigm

Sequence tag IST12243B5HMF1
Sequence
ATAGTACATTCCAGGACAGCCAGGGCTATGTAGAGAGACTTTCTCACAACAACAACAACAAAGAAAAGTAGATATTTAGC
TAGTCCTGGTGTGTCGCAAAGCTTTAGTCCCTGTACTTAAGGAGGTAAATTGAGAAAATGTCCTATTATGTCACTGAAAC
AGTCAAATAAGATCAGGCCTGGGAAGTATCCTCCAAGCTTAGCCACAAGGAGGCTCTTGAGGACAGTGGTGGGTCTGGAA
TACCAGTAACAACTGAAATTTCATAAGAGAGGTGGCTGAGCAAAGCCAGAGCTGGCATAGATAGCCAGGAGGGAAAGGAA
GCAGGGAAGCATGGGGTGGAAGGAGAAGTCATGACCTGCGCAGGGTAAAAGCTGATGAACAGAGCAGTACAGGAGCCTTG
CAGCCTCAGGACAGGAAGCAAAGGGCCTGGATCCTGANGCCCANGGGAACGACATGATCTGAAACAGCANCATGGCCCTT
GCCCTTN
Sequence Type genomic DNA
Unitrap ID UNI36293

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 96523843..96524328 480
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028099 (Polr3c) NP_083201 polymerase (RNA) III (DNA directed) polypeptide C Gene [Source:MGI Symbol;Acc:MGI:1921664]


Sequence tag IST12243B5BBF1
Sequence
ATAGTACATTCCAGGACAGCCAGGGCTATGTAGAGAGACTTTCTCACAACAACAACAACAAAGAANANNNNATATTTAGC
TAGTCCTGGTGTGTCGCAAAGCTTTAGTCCCTGTACTTAAGGAGGTAAANNGANAAAANGNCCNANNANGTCACTGAAAC
AGTCAAATAAGATCAGGCCTGGGAANNNNCCTCCAAGCTTAGCCACAAGGAGGCTCTTGAGGACAGTGGTGGGTCTGGAA
TACCAGTAACAACTGANNNNNNNTAAGAGAGGTGGCTGAGCAAAGCCAGAGCTGGCATAGATAGCCAGGAGGGAAAGGAA
GCAGGGAAGCATGGGGTGGAAGGGAGAAGTCATGACCTGCGCAGGGTAAAAGCTGATGAACAGAGCAGTACAGGAGCCTT
GCAGCCTCAGGACAGGAAGCAAAGGGCCTGGNNCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028099


For any suggestions or comments, please send an email to unitrap@crg.es