Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14319C10
Clone ID IST14319C10
Vector VICTR74
Project tigm

Sequence tag IST14319C10BBF1
Sequence
CTAACGGCCCAGGGATGTGAAGATGGAGCAAAGAAATGGAGGGACCCATAAAAAATTGCAACAGAGGAGCCTTGAAAAGT
AATTATGGGAATATTTATCTCTTCTGTAAATTCCTCTGGGTCTGGGGGAACAGCTCAGTAATAGAGCATGCTTANCATGC
AAAGGCCTTTGGTGTGAGCCTCAGCTTACGCACACAAGTTGCTTTTGTTGTTGATGGTATTTGAGACAGAATCTCTCTGT
ATANCTCAGGTTGGCCTGGAACTCACTCTGTGGACCAGGCTGGACTCCTATTCAGTATATTGCTGAGGGTGACCCGGAGC
TCCTGATCTGCCTGCTTCTGCCTCCCGAGAGGATTTCTACACCCNNCGCATTTCANCTCTTANAGGGATTTACTTACTTN
NNNNCTGTCNGGAAAAAANTCTGCAGGCANAAAATCTTATNNNTCAATCTGTANGGGGCTGGAGAGATGGTTCAGGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130202394..130202870 440
NO GENE  


Sequence tag IST14319C10HMR1
Sequence
AATAAAGGGGGCAAGAGATTAAAAAAAGAAGAAGAAGAAATGTGGGAAGCAGAAAGAAAGGAAGAACTCAGAAAACCNNN
TCCTCAGGGCAAAGGGTCTAATGCAGAGGCACCCCCGACTGTGGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114418761..114418888 122
NO GENE  


Sequence tag IST14319C10HMF2
Sequence
TTTGTATAACTTTACCAGCTAAGGGGCTTTAATACCAAAGAAAATGTTTTGTTTTATTTTGAAAATGGTTTTATTATAGC
TTTTATTTGGGTTTTGGGGGTTTTTTGGTTTTGTTTTTATTTTTTTGTTTTTTCAAGACAGGGTTTCTCTGTGTAGCCCC
GGCTGTCCTGGAACTCACTTTGTANACCAGGCTGGCCTCGAACTCANAAATCCACCTGCCTCTGCCCCCCGAGTGCTGGG
ATTAAAGGCGTGGCCCCCACA
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114418504..114418762 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es