Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11540H2
Clone ID IST11540H2
Vector VICTR76
Project tigm

Sequence tag IST11540H2HMR1
Sequence
CTCTNACATTTTCTCNNCTCACTCCACACTCACCTCACACACACCTTATGAGCACCCCACTTGCTCTCCACTCCTCCTCA
CTCGCTCTCTCACCTTTCTCTTGCCCCAGTCTTTTATTGATACTCCAAAAGCAGGTANAAAAAAAGACATTGTATAATCA
TTGCCAAATCAAATTCAAAAGAATAACCACATCCCACAAAGAATCAAGAATTACAATCGCTCCCCAAAGTTTCAAGCTTC
CCTATTCCCAGGCCTGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI36297

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52739502..52739762 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011382 (Dhdh) NM_027903 dihydrodiol dehydrogenase (dimeric) Gene [Source:MGI (curated);Acc:Dhdh-001]

 
Come back to gene ENSMUSG00000011382


For any suggestions or comments, please send an email to unitrap@crg.es