Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12793C8
Clone ID IST12793C8
Vector VICTR76
Project tigm

Sequence tag IST12793C8HMF1
Sequence
AAACCCAGAACTGATTTCTAGGCCTACCAGGAAGTGGTGAGCCTTCAGGAAAAGACTGCTTAAGCTTTGTTGAGCATGGA
CAGGAGACCTACAACAAACCGATTTGGTTGATGGCAAGTTANTTCAGAAGGCAGGGAATTAAAGGTGGTTTGTTTTGACT
TAACTTTTATATTNAAAAGATTATTTTTAAAAAGATGTANCCGGGCGTGGTGNCNCNCACCTTTANNCCNANCNCTCNGG
AGGCAGAGGCNGGCGGATTTNTGANTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12793C8BBF1
Sequence
AAACCCAGAACTGATTTCTAGGCCTACCAGGAAGTGGTGAGCCTTCAGGAAAAGACTGCTTAAGCTTTGTTGAGCATGGA
CAGGAGACCTACAACAAACCGNNTTGNTTGNTGGNNANTNANTTG
Sequence Type genomic DNA
Unitrap ID UNI14590

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4606525..4606638 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009076 (Zmat5) NM_026015 zinc finger, matrin type 5 Gene [Source:MGI (curated);Acc:Zmat5-001]

 
Come back to gene ENSMUSG00000009076


For any suggestions or comments, please send an email to unitrap@crg.es