Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14972B11
Clone ID IST14972B11
Vector VICTR76
Project tigm

Sequence tag IST14972B11HMF1
Sequence
GTGTGAGGACTCCAAGATGCAAGATGTACAAGTGATGACATCACTGTCAGGCAGACTGTAAGTACCATATGATGGGCTTG
TAAAATAAAAAATGAAATAAGCTGTCAACGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20519312..20519421 110
NO GENE  


Sequence tag IST14972B11HMR1
Sequence
TATGAAATGGACACTGATGAAAATCAGGAGACTAGAATGAAAANNGNNNCAATAAAGCTGACCCTAGGCCACACAGCTGG
TAAATGACAGANTNNGTTTGGATATGGGGGACTCTCACTCCAAAATATAAAGTCTGGATCACACCATTGTAGAGGTGTGT
GTGTATGTATGTATGTATGTATGTGTATGTGTGTTTGTATAGGTGTCAGAGGGAGAGAGGGAGAGAGAN
Sequence Type genomic DNA
Unitrap ID UNI36298

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20519427..20519654 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003233 (Dvl3) NM_007889 dishevelled 3, dsh homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:108100]


Sequence tag IST14972B11BBF1
Sequence
GTGTGAGGACTCCAAGATGCAAGATGTACAAGTGATGACATCACTGTCAGGCAGACTGTAAGTACCATATGATGGGCTTG
TAAAATAAAAAATGAAATAAGCTGTCAACGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20519307..20519421 115
NO GENE  

 
Come back to gene ENSMUSG00000003233


For any suggestions or comments, please send an email to unitrap@crg.es