Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10084G8
Clone ID IST10084G8
Vector VICTR75
Project tigm

Sequence tag IST10084G8BBR1
Sequence
AGCTCTGACGCGGGTCCCCAGAGTGGCCGGGGGTAATCTCTCCGAAGCTCCATCTGGCTTGCGATTGTTTTTCTCTAGAT
TGCCTTCCCTCTCTCCCTAACCCAGCTATTCTGAAGAAAGCGCGGGCATCCGATTGCTGCGGCTTTCCTTTGCTTTTTGA
CTTTATTGGACCTAAACTGGTGGGCACTGACAGTTGAGAGGTTCCCCACACAGATGTTCAAAGCGGCCCCTTTGAGGAGG
CCAGGACCGGTCTTGCTCCTTTCCAGTGAGTTTGGAGGGATTTAGGTTGGAGCTCTAGAGTTTCCACTATCCAGACTGCG
GGAATGTTTACAAGGTGGATGGATTTAGGTAGGGCTCACCCCAAACCGACCCTTTGTAGCTGAAGCACCTGGGTGGGGCT
TAGGGCGGTGAAGCTCAGGGTCCGCCTAGTGGCAGAGTCCCATTAGCTTTCTGTTATAAATTCTTACACTTCCAGTAAGC
AGCGATCATCCCCAGTGCTGTAAGGAAGGAGACTGGCAGCCAGAGCCCGTGTAGCTTGCACATTCTTAGAAGGACGCGCC
CAATTTCCCAAGTTTAGAACTGATCACGTGATTTCAGCTTCTCAAGTGGTTTCA
Sequence Type genomic DNA
Unitrap ID UNI13223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124114972..124115589 598
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031812 (Map1lc3b) NM_026160 microtubule-associated protein 1 light chain 3 beta Gene [Source:MGI Symbol;Acc:MGI:1914693]

 
Come back to gene ENSMUSG00000031812


For any suggestions or comments, please send an email to unitrap@crg.es