Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11837F10
Clone ID IST11837F10
Vector VICTR76
Project tigm

Sequence tag IST11837F10HMF1
Sequence
CTATTGTTAAGTGTGTTTCTCTGATGTCTGGCTCANCATATTTATTGTTTCTATAAAGGAGGAATACTGTTTTTTAGTTA
ACTTTGTATTTTGCCACTTGGCTGAAGACATTTATCATCTGTAGGCACTCTCGGGTAGAATTTTTTTGAGTCACTTACAT
ATACTGTCATATCCTCTCTGACTAACTATACTTTGACTTCTCTTCCAATTTGAATTCACTTGATCTCCTTCAGTTGC
Sequence Type genomic DNA
Unitrap ID UNI36302

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 89014617..89014852 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074146 (4930579C12Rik) RIKEN cDNA 4930579C12 gene Gene [Source:MGI Symbol;Acc:MGI:2441687]

 
Come back to gene ENSMUSG00000074146


For any suggestions or comments, please send an email to unitrap@crg.es