Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST442808
Clone ID OST442808
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST442808
Sequence
TTTTGTGGGTTACCCCTTCGGTNCANTTGTCAGGACCAANACCATCGTCCAATACCGCCTCGAGCATGAAGTCTTTGAAT
ATATTATATTCCGCGGGAGTGATATTAAAGACCTCACTGTTTGTGAGCCACCCAAACCACAATGTTCTTTGCCTCAGGAC
CCGGCTATTGCTCAGNCTTCACTAGGTTNGTCGTCATCTTCATTCCAGTCGGTGGGTTCCTANGGACCTTTTGGCANGAT
GCCAGCATACAGTCAGTTCAGNCCAAGTACATTAGNNGGNCAGCAGTTTGGTGCTGTNGGTGTTGCTGGAANCTCTTTGA
CATCCTTTG
Sequence Type mRNA
Unitrap ID UNI6941

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 35150733..35160405 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066568 (Lsm14a) NM_025948 LSM14 homolog A (SCD6, S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm14a-001]

 
Come back to gene ENSMUSG00000066568


For any suggestions or comments, please send an email to unitrap@crg.es