Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12267D9
Clone ID IST12267D9
Vector VICTR76
Project tigm

Sequence tag IST12267D9HMF1
Sequence
GGCTTTAACACAGTAAGTAGAGAAACCCAAGAAGAGGACTTACTGTCCAACCACTGTGCTAACAAGGGCACAAGGCTGTC
CCAGTAAATAATTACTTCTTATATACTTGGCTGGGGTAATACTCATTGAAACAAATGTAGTATTGAAGGAAGACTGAAGG
AGTCACTACCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI16579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20130265..20130438 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]


Sequence tag IST12267D9BBF1
Sequence
GGCTTTAACACAGTAAGTAGAGAAACCCAAGAAGAGGACTTACTGTCCAACCACTGTGCTAACAAGGGCACAAGGCTGTC
CCAGTAAATAATTACTTCTTATATACTTGGCTGGGGTAATACTCATTGAAACAAATGTAGTATTGAAGGAAGACTGAAGG
AGTCACTACCCTGGCCAGGAAGGTGGGTCTTTCACTCTTTCCAGTGTCTTGTTAACATGTGCTTGCTGAGCTGCATATCC
CACATTCCCATACGGTGTTCTCTACCTCTACTGCTACACCACACAGCAGACAGCAGCAGTAATCCTTACAGTGCTACTCT
CTCCAGTGTGGGGCTGCGTTCAAGACTGTCCCTGTCCTACAGGCTCTCTTGCTCAACTCACTCAGCACCTGTCTCCNAGC
ATCTCTGACAACACAAACGTCTACNAAAACCCAGTTACTTGCCAGANCGCTATGCTACAAAGGACCTTTGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI16579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20129962..20130438 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es