Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0638
Clone ID XR0638
Vector pGT0lxf
Project sanger

Sequence tag XR0638
Sequence
TCGGGTCATGGAGGCCTCGGGAGGCGTAGGGGGCGCCTTTCC
Sequence Type mRNA
Unitrap ID UNI3352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 18595589..18595629 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039842 (Mcph1) NM_173189 microcephaly, primary autosomal recessive 1 Gene [Source:MGI (curated);Acc:Mcph1-001]

 
Come back to gene ENSMUSG00000039842


For any suggestions or comments, please send an email to unitrap@crg.es