Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10031C1
Clone ID IST10031C1
Vector VICTR75
Project tigm

Sequence tag IST10031C1BBF1
Sequence
TTAGGAGTTACAATCCAACTATCCCCAGTTACAATCCAACTCATCCCGGTTTTTTTTTTTTTTTTTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096954..58097019 66
NO GENE  


Sequence tag IST10031C1HMR1
Sequence
CTACTCCCTGAAGCCTTGCCTGAAGCGCCTACCTCAGATGAAAGACTATAGTCCTGTGGAAGGCC
Sequence Type genomic DNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096892..58096956 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]

 
Come back to gene ENSMUSG00000036986


For any suggestions or comments, please send an email to unitrap@crg.es