Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12351H3
Clone ID IST12351H3
Vector VICTR76
Project tigm

Sequence tag IST12351H3BBF1
Sequence
ATGCCCCGCCTCCAACCCTGACGCTTCCAGCCGCCGTGAAAGCCTCAGCAGTGGCACAGTCCCCTGAGCCGGCAGCTGCT
GCCCCTGTGGGGGAAGGTAATGCGGGCCTCTTTGCTGGAAGGATCACGCTCTGGGTGTTTTTCTCATGTGGCGAGCCGCT
AGCACGCAGTTCTACTATGAAAATAGCTAAACTTAAGCTCTTCTCGGTATTAAGTTTTTCATAAATTTCTACATTTTAGA
AGAGTAAAAAGACCGTAATAATCATTGAATTTTTATCCTTTTAAAACATTTTACTTTGTTTATGTACATGAATGCTTTGG
CTATATGTCTGTCCCCCACATGCACACCCTGTGCTCACAGAAGCCAGAAGANGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI36303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20179653..20180036 382
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es