Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14995C2
Clone ID IST14995C2
Vector VICTR78
Project tigm

Sequence tag IST14995C2HMR1
Sequence
AAACTATNANCAAACTCCAATTAAATGCTTACTTTGATAANANTTGCCNTGCTCNTGGTGTCTCTGCTCANCAATANAAC
AGTAACTAAGACAGGATGCATGGGTGATTGAGACATAACAATACGACCTCCAATGTTTGCAGTATAATANAATAACAATT
CAATCACAAAATATATTTCATANATGANATAAAACTAAAAAAATGAGGAAACAGTGAATGATGAAAAAAGATCTGTGCTA
CATTCAAATGATGAACCACANTACTAAAGAAATAATTTTAATGGATGTTCTATGCAAAATATNNCANCATGATACTGTGC
CCAGGAAGCCTCCTGANATTGGCTGCTCTTTCTTCTCTGAGAGAGTGGACTTGATAGTANCAGGCTGGTAACCTCAGGGA
TGATGGATTNCNNANNNCAGAANCTGAGGGGTGANGGGCTCTGGNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14995C2HMF1
Sequence
GGCGGGTCCCGGACCAAGATGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGGGTGGGCNCCNGTCCTCNG
GTCCNGNNNGN
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29644 UNI30806 UNI30811 UNI31345

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11616703..11616786 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5435030..5435113 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 13216009..13216092 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14004825..14004908 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 5097873..5097956 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 7462459..7462542 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 20252727..20252810 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19348647..19348730 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692815..11692898 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10881869..10881952 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 27826046..27826129 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14210037..14210120 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026712 (Mrc1) NM_008625 mannose receptor, C type 1 Gene [Source:MGI (curated);Acc:Mrc1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 5055405..5055488 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5642019..5642102 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3987749..3987832 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 10655551..10655634 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 12874959..12875042 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3913782..3913865 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4771865..4771948 78
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 37020555..37020638 78
NO GENE  

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es