Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10984B5
Clone ID IST10984B5
Vector VICTR76
Project tigm

Sequence tag IST10984B5BBF1
Sequence
ATGTGAATTCAAGGCCAACTGAAGCCAAACATTGNNNACCCTGTCTAAATAAACAAAATAAAACCCAGGCGGAAGCAAAG
GCAAGCCCTGCCAGATGTGGCCTGTGGGGACAGGCACTGACCCTGTGACCTGGCCTGCAAAGAGTGTCAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI10803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20327286..20327438 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062300 (Pvrl2) NM_008990 poliovirus receptor-related 2 Gene [Source:MGI Symbol;Acc:MGI:97822]


Sequence tag IST10984B5HMR1
Sequence
ACATCAATCCTCCTGTCTCACCATCCAGAAGAGCTGGGATTACACAGCTTTGCAAATGTGAATTAGAACAGGTCTTGGAG
CTAGGCAAAAGGACATCAAGGACAGAAAAATGGGCTTGAAAAGGTGTCGGGGAGGGGTTGGTGAGATGGCGCAGCGGGTA
AAGGTGATTGCANCCAAAAATGATAACCGGATTTTAATCTCTGAGATCCGANTANTGNATANGGANAACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20327435..20327663 215
 
EST/CDNA Est Name
  BU152119.1 - CN691547.1 - BY328819.1 - BB870363.1 - BY351733.1 - BY352787.1 - BY335903.1 - BY347355.1 - BY789255.1 - BY329729.1 - BB868636.1 - BY345176.1


Sequence tag IST10984B5HMF2
Sequence
ATGTGAATTCAAGGCCAACTGAAGCCAAACATTGNNACCCTGTCTAAATAAACAAAATAAAACCCAGGCGGAAGCAAAGG
CAAGCCCTGCCAGATGTGGCCTGTGGGGACAGGCACTGACCCTGTGACCTGGCCTGCAAAGAGTGTCAGATCTTTTACTT
GAATTGTTCCAGGGGAACCTGCAGGGTGACTTAAATGTCTCCATTTTACACATGAAAGAACTTGGGCTTGAAAAGGTCAC
CCANCCCAGAAGCAGCAAGCAGCANGAAGCTCTCATCTCTCTGTGTTTCAATTTGAAAAAGTTCTCCTGCTCCTCTGTGG
TAGGGCTGGGACCCAAAGCTCTCCACGTGGTACACAAGCGCTCTGCCNCTGANCCACGCCCNNNNNNNNTNNCTGGGGGA
TTCTAGGCANGGGCTCTGCCNCTGANCCNCGCCCCCAGCCCCTCCCTGGGGGATTCTAGGAAGANGCTCTACTGCTGANC
TGTCCTTTTCCTANTNNATATNGATCCGCTCTGCGGCANANATNAAGCCCTTTTTGTCTAGGTGTGTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene BU152119.1 - CN691547.1 - BY328819.1 - BB870363.1 - BY351733.1 - BY352787.1 - BY335903.1 - BY347355.1 - BY789255.1 - BY329729.1 - BB868636.1 - BY345176.1


For any suggestions or comments, please send an email to unitrap@crg.es