Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12830C1
Clone ID IST12830C1
Vector VICTR76
Project tigm

Sequence tag IST12830C1HMF2
Sequence
ATAGAACTGTTCAATCTGTCCNCATTCTTAATCTTATNAACCTGAGCTTATTTTCAGACTCAGCATAATCTGAAACTGTT
AACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 63375332..63375414 79
NO GENE  


Sequence tag IST12830C1HMR1
Sequence
ANATTTTTGGAAAAATATAGCTAAATTTGTTTCTTCCCCCAAAACATCAGAAAACTTCATAATGCTGGCTCAATTTCAAA
CTCTGCTTATTTCAAACTGTAGTTATTCTCTTAAGGCTAACTGCTTGTTGGGCTGTTTAATGCTTGCTTGCTTGATTGCG
TGGGACAGGATCTTCTTTCTTGTTCAGCCTANGCAGACATANAGCACGTTCTTTATCCTACCCTGGGCTTCAAAAGGAGG
CCATCCTTCTGCCTCAGCTGTANATGCTTGGTGTTGGGCTTTGTTTCTTGGAACCNCATGCTGANTTCACTCCTACTTAC
ACTTTGCTTTCCAGANCCNAGCTGANCANCCTGCNNGTCC
Sequence Type genomic DNA
Unitrap ID UNI18905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30505013..30505369 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039697 (Ncoa7) NM_172495 nuclear receptor coactivator 7 Gene [Source:MGI Symbol;Acc:MGI:2444847]

 
Come back to gene ENSMUSG00000039697


For any suggestions or comments, please send an email to unitrap@crg.es