Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10698G7
Clone ID IST10698G7
Vector VICTR76
Project tigm

Sequence tag IST10698G7BBF1
Sequence
GAGGTAGACCTGACCTTTGGGGAACACAATGTTTAAGTCACTCCACCTCCCTTCANTCTNATTGTCAAAAACTTAAAGAT
TGACAAACAGGCTGCTGTCGGTGGCTTCCTCAGCGTCCTGGGAGAGCAGTCCACCCAAGCACATGCATTAAGTGTGTGAN
GCTTGCTTTGTCATCAAATTTTAATTATTACCACGTTTTGGGAGTTCTAGAAAATGCCAGTGATAAATACTGTTTCTCCT
ACATCTGTTGTTGGGCTGCTAANTTTTTNTGTTTGTTTGTTTTGTATGTGGGGTGATCACTCTTTTTTTTTTA

Sequence Type genomic DNA
Unitrap ID UNI3618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135193752..135194063 302
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST10698G7HMF1
Sequence
GAGGTAGACCTGACCTTTGGGGAACACAATGTTTAAGTCACTCCACCTCCCTTCANTCTCATTGTCAAAAACTTAAAGAT
TGACAAACAGGCTGCTGTCGGTGGCTTCCTCAGCGTCCTGGGAGAGCAGTCCACCCAAGCACATGCATTAAGTGTGTGAN
GCTTGCTTTGTCATCAAATTTTAATTATTACCACGTTTTGGGAGTTCTAGAAAATGCCAGTGATAAATACTGTTTCTCCT
ACATCTGTTGTTGGGCTGCTAANTTTTTTTGTTTGTTTGTTTTGTATGTGGGGTGATCACTCTTTTTTTTTTA
Sequence Type genomic DNA
Unitrap ID UNI3618

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135193752..135194063 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es