Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12044G5
Clone ID IST12044G5
Vector VICTR76
Project tigm

Sequence tag IST12044G5BBF1
Sequence
GTAGTTGTCTTCAGACACACCAGAAGAGGGCATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI226 UNI15799 UNI25857 UNI26409 UNI29950 UNI36306 UNI36307 UNI36308 UNI36309 UNI36310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155391264..155391303 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042684 (Npl) NM_028749 N-acetylneuraminate pyruvate lyase Gene [Source:MGI Symbol;Acc:MGI:1921341]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75037427..75037466 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006345 (Ggt1) NM_008116 gamma-glutamyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:95706]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86301476..86301515 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020521 (Rnft1) NM_029788 ring finger protein, transmembrane 1 Gene [Source:MGI (curated);Acc:Rnft1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4854800..4854839 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051721 (BC068281) NM_173416 WD repeat-containing protein C2orf44 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NV72]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 61902869..61902908 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 45781415..45781454 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021830 (Txndc16) NM_172597 thioredoxin domain containing 16 Gene [Source:MGI Symbol;Acc:MGI:1917811]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 59236384..59236423 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059586 (Nsmce2) NM_026746 non-SMC element 2 homolog (MMS21, S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1915751]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84826985..84827024 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45621740..45621779 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36418714..36418753 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 36816334..36816373 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165792063..165792102 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68786199..68786238 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 98850564..98850603 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 23637844..23637883 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028986 (Klhl7) NM_026448 kelch-like 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1196453]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 149096922..149096961 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039958 (4833442J19Rik) NM_177101 RIKEN cDNA 4833442J19 gene Gene [Source:MGI Symbol;Acc:MGI:2443575]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134192164..134192203 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 43479072..43479111 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21187689..21187728 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032178 (Ilf3) NM_001042709 interleukin enhancer binding factor 3 Gene [Source:MGI Symbol;Acc:MGI:1339973]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34290082..34290121 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037636 (Slc25a43) NM_001085497 solute carrier family 25, member 43 Gene [Source:MGI (curated);Acc:Slc25a43-001]

 
Come back to gene ENSMUSG00000037636


For any suggestions or comments, please send an email to unitrap@crg.es