Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10023G5
Clone ID IST10023G5
Vector VICTR75
Project tigm

Sequence tag IST10023G5BBR1
Sequence
ACACGATCTGTGAAGATATGAAATGTGTGCATGAGGTGTTAAGAGGAACAGCTGGGTGTTATCAAAGCTGTTTTCATGAA
GGCTCCCACAACAGTCTGCTGTACACTGGGTGGTTTAACCTTTGTCCTCTCTCCTGGTGAGGCTAGATCC
Sequence Type genomic DNA
Unitrap ID UNI36312

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 23974777..23974925 149
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024277 (Mapre2) NM_153058 microtubule-associated protein, RP/EB family, member 2 Gene [Source:MGI (curated);Acc:Mapre2-006]

 
Come back to gene ENSMUSG00000024277


For any suggestions or comments, please send an email to unitrap@crg.es