Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11720B7
Clone ID IST11720B7
Vector VICTR76
Project tigm

Sequence tag IST11720B7HMF1
Sequence
TTCACGATTGATTTTTAAATGGCTTACAGAGGGCGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI36313

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 12911703..12911742 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031442 (Mcf2l) NM_178076 mcf.2 transforming sequence-like Gene [Source:MGI (curated);Acc:Mcf2l-009]

 
Come back to gene ENSMUSG00000031442


For any suggestions or comments, please send an email to unitrap@crg.es