Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14539B9
Clone ID IST14539B9
Vector VICTR74
Project tigm

Sequence tag IST14539B9BBF1
Sequence
TAATACCTATAAAAATTTCAAATACCTCTTTNACAGAAACAGACAAGCANATTCTAAAACCACAGAGAANTGCNNGGGAT
CT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14539B9HMF1
Sequence
ACTGTAATACCTATAAAAATTTCAAATACCTCTTTCACAGAAACAGACAAGCAGATTCTAAAACCACAGAGAAATGCAAG
GGATCCAAAGCAAAACAAGCAGTTTGAGGAAAGCTGGCTTCATATTTCAGTTTCAGAATTACTACAAAGCCATACAGCAG
CCATCACACAGTGTGATGCTGGCAACAGCCAGACACAGACAACGGAGCAGAGCCACGAGCCAGGAGAGAAACTTCACTTA
TGGAAAACCAAGGGCACAAAGACAACTCAGCGAAGACAGTCTCCTAAATGGATGGCACTGGATAGTAGCATTCCCTGCAA
AACAATACAGCTGGATTTTATCTCAAAATTGAGCAAGTGGAAAAGCTAAACTAAAATGCCTAGAATAAAACATAAATCAG
TTTAATCATCCTGGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105385524..105385939 416
 
EST/CDNA Est Name
  CN460888.1 - CJ058235.1 - CA466296.1 - CF540323.1 - CA883529.1 - BF140287.1 - BU703504.1 - BY132364.1 - BB622576.1 - BB662496.1 - BX516568.1 - AI789307.1 - BY157285.1 - BU611728.1 - BY159422.1 - BQ939400.1


Sequence tag IST14539B9HMR1
Sequence
NNTGACTTGTTCTTTACTGAGGAGGTATTCTTGCATAGGTAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI31830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 105385474..105385524 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032570 (Atp2c1) NM_175025 ATPase, Ca++-sequestering Gene [Source:MGI Symbol;Acc:MGI:1889008]

 
Come back to gene ENSMUSG00000032570


For any suggestions or comments, please send an email to unitrap@crg.es