Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11466A5
Clone ID IST11466A5
Vector VICTR76
Project tigm

Sequence tag IST11466A5HMR1
Sequence
NAGCAGCCNGTAGGGCCNCCAAGGTGGCTTCACTGGCACTTCCCTGAATCCNAGAGAAAAAGGCCAAATGAAATTTGAAA
TGTTGCAAAGAANNCNNAGTCTAAACTTTTGGAAGACATATTATTTATGTCCATAGTTTCCTTTAAAAGTTGAGCCAGAA
ATTGCAAAATTCACTCATTTTTGCATCTCACATCTGCAGGGGCTGGTTTAGCTCTTGTACCNNCTTANNNNCNGGTGNNG
NGNCNNNNNNNCCCAGTGAGCTAGCACTCTGATCCTGTAGCATATACAAGACTCTGCAGGTGTTCTCTCATGGGTTCCTT
AAGCCGTCTGGGACATACTGTCTCCACTTCCATCAGAGGAAGAGACTGATCCAGGGCAACCTGCCCAATCCCTGCTCTGT
GTTCCTATGCATGTGGACAGAACAATTTGTATTTGCTTATAACATAGGAATGCATTTTCCTTGACACGCAGAGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11764990..11765464 225
 
EST/CDNA Est Name
  BI217405.1 - AA474389.1 - W64680.1 - BY134120.1


Sequence tag IST11466A5BBF1
Sequence
CTCGGACTAAAGTTATCCGCCAGCTGCAGGCAGCCTCCCCAGAGTTCACACAAGCTGCTATCATGGAAAAGCTGGTTGCT
TACACATCTGATCAGGTGAGTGTGCTGGTGTGGGCATTGGCCCNNCACCCGACAGCCCCCACCTCCCACCCCCATTCTCC
ACCGNNAAGCTGAATCCAAGGAACAGTTANCATCACGTCAAATCCAAAANCTGGTCCTTCGGGATCACAAGGCANAGAAA
CTCCTCANTCTATCGTGGGAGCTTGATAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI36317

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11764719..11764991 253
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020182 (Ddc) NM_016672 dopa decarboxylase Gene [Source:MGI (curated);Acc:Ddc-001]

 
Come back to gene ENSMUSG00000020182


For any suggestions or comments, please send an email to unitrap@crg.es