Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10061F10
Clone ID IST10061F10
Vector VICTR75
Project tigm

Sequence tag IST10061F10BBF1
Sequence
CCATCCTAGACCCAGCTTCTGCTCTCCTGTTCCTAGCCTCCCCAAGGCCAACAGCAGCCAGCCAAACACACACCCACTGG
CCCACAATGCACCTGGGCTCTGTGCCCAGTACCTCCTTCCAGAATCCTTCCTCCTGCTATCTTACTCCAAAGGGACAAGT
CCCACCCCACCTTGTGGAGGCTCGGGAGTCCATCTGATTGCCTCCTGCTGCAGACTGGGATGTGTCGTCCTGCTCCTCCA
CCCTGGCATTGCCCACTACCCTCCCCCAATCTACATCCTAGTGATGATAATCACCATCTTTTCCTGCCTTTCCCTGCCCC
ACGATGCATCCAACCTCCTGACATCACTCTGACCCTTCTCCTATACCCAGTCTCCTCTAAGGCTCAGTCATGAGCCCTTC
CTGTTCCCAAGAGCAAAACGTTAGGACTTTCTCTGAGGAAGAAAAATGGCCTAGAGCCCCTTCTCACTGACTTCTGCTTC
ATTTTGTTGTGAAACAGGGTCTTTTGGGGCCCAAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3593237..3593752 512
NO GENE  


Sequence tag IST10061F10HMR1
Sequence
GGAANNGNCAGTGGAGGCAAGGGGCAGGAGGAGGTGAGGGAGAGGAAAGACAGGACCGCCAAGACCAAGTTCTCAGCACA
AAGGATATGTATTTGTCCCAGAGGAACAGAGCACAGGAATAAAGGACAAAGACAGGAGATAAGGAGGGAGAAGGGGAAGG
GTCAAGGGAGAGAGAGGGGAGAGAAGGGGAAAGGGAGAAGGGGAAGGGGTATTTGTCCN
Sequence Type genomic DNA
Unitrap ID UNI36319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3593781..3593998 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044433 (2310057J16Rik) NM_027171 RIKEN cDNA 2310057J16 gene Gene [Source:MGI Symbol;Acc:MGI:1916947]

 
Come back to gene ENSMUSG00000044433


For any suggestions or comments, please send an email to unitrap@crg.es